RecclezzRosa
RecclezzRosa RecclezzRosa
  • 02-04-2020
  • Mathematics
contestada

What is Gcf of 2x^2 + 6x?

Respuesta :

fussellk
fussellk fussellk
  • 02-04-2020

Answer:

2x

Step-by-step explanation:

they have a 2 in common and 1 x in common

Answer Link

Otras preguntas

The slope of the line passes through the points (2,3) and (5,9) is
in humans homeostasis involves controls of all the following except
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Parasitism relationship between 2living things. Explain the relationship.
Read this excerpt from a New York State commission investigating living and working conditions in tenement houses. Another great evil of tenement house manufact
Summarize the Environmental Treaty of the Kyoto Protocol. What were the results of the treaty?
In Pasteur's experiments, why didn't bacteria grow in the long necked flask?​
Two friends share popcorn at a movie. Aaron eats 1.5 of Bub eats popcorn.of the popcorn. cups Together they eat all the popcom. How much popcorn did they have?
How can I say this in Korean? I only know how to say half of it lol“I was supposed to study abroad in Korea next semester but, corona is ruining my plans.”미리 고마
Which states are home to more than half of the foreign-born population? 1)Florida, California, and Texas 2)New York, Arizona, and California 3)California, New