esmeralda4739 esmeralda4739
  • 01-09-2020
  • History
contestada

Which of the answers below best describes the goal of the Dawes's Act?

Respuesta :

davidjaniel
davidjaniel davidjaniel
  • 01-09-2020

Answer:

Explanation:it the A

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
define concentric circles
what is 15/24 in simplest form
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a