moniquereese11 moniquereese11

03-10-2020
History

contestada

Georgia, pennsylvania, or Virginia . Plzzzz help me

Georgia pennsylvania or Virginia Plzzzz help me class=

Respuesta :

jaramilloyamir jaramilloyamir

03-10-2020

Answer:

i know that James is right i live near Oglethorpe in Savannah GA

Explanation:

Answer Link

Otras preguntas

Kira runs 3 miles in 28 minutes. at the same rate, how many miles would she run in 42 minutes

Why does Helen go to bed happy at the end of the chapter?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is the lowest level of measurement that a median can be computed?

if f(x)=4x-6, what is f(6)

A new predator is introduced into the ecosystem shown in the food web below. This predator feeds on bees and mice. How will this most likely affect the specie

hich of the following sentences is correct? A. Seven thousands of people showed up for the concert. B. Does anyone know why Steve ordered five dozens of eggs? C

True or false: martini di arma di taggia invented the martini in 1911 for john d. rockefeller at new york's hotel knickerbocker.

PLEASE I BEG YOU, HELP ME!!!!!!!! Find the rate of change of the function h(x) = 2^x on the interval 2 ≤ x ≤ 4. The rate of change is what?

Name the five transport mechanisms of the cell: