Seudónimo Seudónimo
  • 01-12-2014
  • Mathematics
contestada

what is 3/8 in simplest form

Respuesta :

Jaynice
Jaynice Jaynice
  • 01-12-2014
3/8 cannot be simplified anymore, because 3 doesn't go into 8. Therefor 3/8 is the simplest form. Hope this helps!
Answer Link
raine2019322
raine2019322 raine2019322
  • 01-12-2014
3/8 is the simplest form. It cannot go any further because 8 divide by 3 equals a decimal. 
Answer Link

Otras preguntas

dexter deposited $6,300 into a savings account that earns 2.60% simple interest per year. how much will he earn in 4 years?
What is conservation?
Select the correct text in the passage. Read this paragraph from a post on a parks department blog about how local businesses can be environmentally friendly. W
Select ALL the correct descriptions that help to define luminosity. A. How much energy is emitted per second B. How much surface area the object has C. The amou
EZ POINTSSS!!! Which change, if any, is needed to the underlined text? took a road trip has taken a road trip will takes a road trip No change​
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
How is basic math used in a business? Give me three examples.
what is (2m+8y)+(4+9m)+(-2 -3
Find the length of the hypotenuse of the triangle.
what is the value of the digit 253,253,253 in the ten millions' place?