amarib45 amarib45
  • 01-02-2021
  • Mathematics
contestada

What is the inverse function of f(x) = x


What is the inverse function of fx x class=

Respuesta :

MrDarkDoom
MrDarkDoom MrDarkDoom
  • 01-02-2021
f-1(x) f(x)-1
Inverse of the function f f(x)-1 = 1/f(x) (the Reciprocal
Answer Link

Otras preguntas

a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
when Jefferson took office he did what
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
how can you write 0.45 as fraction and a percentage ,please show work
what is the percent change from 70 to 56?
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place