petshoponvacation
petshoponvacation petshoponvacation
  • 01-02-2021
  • Spanish
contestada

question is in the pic

question is in the pic class=

Respuesta :

Аноним Аноним
  • 05-02-2021

Answer:

B

Explanation

can i get brainliest

Answer Link

Otras preguntas

Who basically "began" England's religious reformation?
Cheney is buying a house for $216,820. He made a down payment of $26,020 and will finance $190,800. He gets a 15 year fixed rate loan with a rate of 5.815%. Ho
The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side
While the theme of "Ode on a Grecian Urn" focuses on how art is eternal, the theme of "Ozymandias" focuses on how a.royalty is superior. b.nature endures. c.thi
You analyze a cell. the cell starts with two moles of glucose and you see five moles of pyruvate appear. how many atp were produced by glycolysis
crystal lattice definition
Which constitutional amendment allowed voting for citizens who were eighteen or older?
I'm not sure how to do this I was not there that day they taught this and idk what some are and it was yesterday so..
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?