prettylaii17 prettylaii17

01-02-2021
Mathematics

contestada

what's the number line shows the solution to n > 0

whats the number line shows the solution to n gt 0 class=

Respuesta :

alicialuster alicialuster

01-02-2021

3 line I’m pretty sure that’s right

Answer Link

Otras preguntas

How to change 3 7/8 into an improper fraction

Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your

Which word has the long i sound? relieve speciality society social

The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?

In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

how to i do 7/16÷(31/2÷1/2)

Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4

An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.

Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based