pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

Help help plizzzzz!!! Due today!!!!
Charlotte is redecorating the master bedroom in her house. She has already purchased a new bedroom set and also plans to paint the room and put in new flooring.
find the volume of the cylinder with a diameter of 12 inches and a height of 10
Which is bigger 49/54 or 8/9
calculate the percent solute of 1.4g of NaCl in 46.6g of saline solution​
If U is the set of all natural numbers less than 10, A is its subset containing all natural numbers less than 6 and B⊂U consists of all natural numbers greater
I need quick help with #7 for geometry
Which statement best explains how the Constitution addressed a weakness in the Articles of Confederation? A. States were able to make individual trade agreement
What is the authors purpose in writing this paragraph?
Which labels best complete the diagram? Look at the diagram showing resistance and flow of electrons. OX: High resistance Y: Low resistance Z: Flow of electrons