Gordoon Gordoon
  • 01-10-2021
  • Mathematics
contestada

Write the expression without an exponent. 6^-2

Respuesta :

christopherallen
christopherallen christopherallen
  • 01-10-2021

Answer:

1/36

Step-by-step explanation:

When you put something to a negative exponent, you are essentially putting it over 1. So 6^-2 would become 1/6^2. Solving 6^2 gives you 36, so the full equation would be 1/36.

Answer Link

Otras preguntas

ace's grandfather is 3 years older than Ace's grandmother. their combined age is 121 years. how old is each?​
Which new deal program gave money to states and local governments to use for providing money to people who were unemployed? A. federal emergency relief administ
What is another name for the communist insurgents the Americans were fighting in Vietnam? A. Peace activists B. The South Vietnamese C. The Russians D. The Viet
What started off the Ashikaga Shogunate poorly?
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
CAN SOMEONE PLEASE HELP ME!!!!
In at least two hundred words, give two examples from the final two chapters that deal with the theme of the individual vs. society. (Things Fall Apart)
If angle 1 = 80 degrees what is y
Is the flow of power reversible in a worm and wheel gear
Mhanifa please help me with this? I will mark brainliest!