DemarqusL2845 DemarqusL2845
  • 04-11-2022
  • Mathematics
contestada

I need help with a word problem. I would like to send a picture of it

I need help with a word problem I would like to send a picture of it class=

Respuesta :

ParthO492966 ParthO492966
  • 04-11-2022

To solve this problem let's illustrate the box as follows:

As we can see above, even there are 8 cubes inside the box, there is still a space left represented in red. So, we can't say the box is 8 cubic units but the box is 8 cubic units plus the left volume on the top.

Ver imagen ParthO492966
Answer Link

Otras preguntas

Please help solve, thanks in advance!
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
How many times does four go into 153 ? What Is the remainder ?
what is the lcd of 10/11,29/44
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
an explanation describe if a square-eyed pet mates with another square-eyed pet, can they have any round-eyed offspring.
Help pl0x, Algebra 1
the reproductive system of a male mammal provides
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based