sakshipatel152ovrn1u sakshipatel152ovrn1u
  • 04-09-2017
  • Physics
contestada

A generation is about one-third of a lifetime. Approximately how many generations have passed during the last 2,000 years?


Respuesta :

Аноним Аноним
  • 12-09-2017
Assume that the average life expectancy is about 72 years, according to recently published data.
Therefore a generation is
72/3 = 24 years.

Therefore over the last 2,000years, the number of generations that have passed is
2000/24 = 83.3

Answer: 83  generations
Answer Link

Otras preguntas

How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
what is 15/24 in simplest form
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
Susan ........ (Run) to school because she was late.
Please help me with this two step math problem! THANK YOU !!!!!!!!
How has water influenced the development of civilization in Africa