Seudónimo Seudónimo
  • 01-11-2017
  • Health
contestada

Which statement best describes Type 1 diabetes?
Type 1 diabetes is an autoimmune diseases found in some young children.
Type 1 diabetes is considered insulin dependent diabetes.
Type 1 diabetes happens when the insulin producing cells fail.
All of the above

Respuesta :

Becca7828
Becca7828 Becca7828
  • 01-11-2017
The answer is D.) All of the above 
Answer Link
jack241 jack241
  • 02-11-2017
D. All of the above!
Answer Link

Otras preguntas

round 7,782 to the nearest hundred
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
A light bulb converts electrical energy into electromagnetic energy is true or false?
why is the square root of a perfect square always rational
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
testosterone directly affects the
what rule does static electricity follow
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
four yardequal Blank feet