LaPorte2460 LaPorte2460

01-12-2017
Biology

contestada

The thyroid gland is situated between which two structures?

Respuesta :

Аноним Аноним

01-12-2017

Hi the answer to your question is called the jugular notch and the cricoid cartilage that the thyroid gland is between.
Hope this helps.

Answer Link

Otras preguntas

What is [tex] \frac{1}{x+2} +\frac{6}{x-5} [/tex] equal to?Please show most of your work!!!Thank you!!

help quick please!! Thanks

why are the hindlimbs important on the frog

You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome

The perimeter of an equilaterak triangle is 858 millimeters. find the length of each side

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How many grams of potassium hydroxide are needed to prepare 600 ml of a.450 m koh solution?

In which sentence does the underlined noun clause function as the object of a preposition. Our group sends whoever requests information a newsletter and a link

A hexahedron is a prism whose base is a _____. A. equilateral triangle B. square C. circle D. triangle

what is the scale factor of a cube with a volume of 343 m^3 to a cube with a volume of 5'832 m^3?