bmisses
bmisses bmisses
  • 03-03-2018
  • Mathematics
contestada

What is the sum of the first 7 terms of the series −4+8−16+32−... ?

Respuesta :

Equanimity
Equanimity Equanimity
  • 03-03-2018
-4 + 8 = 4;
4 - 16 = -12;
-12 + 32 = 20;
20 - 64 = -44;
-44 + 128 = 84;
84 - 256 = -172.

The sum of the first 7 terms in this series is -172.

I hope this helps!
Answer Link

Otras preguntas

find the prime factorization 504
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
a summary about concussions